Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator DR2501 in Deinococcus-Thermus

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: DR2501 - Deinococcus-Thermus
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Deinococcus deserti VCD115
Deide_01360 DR2501 -124 6.5 GATCTGAAACGTTTCAGATC
Deide_01350 DR2502 -51 6.5 GATCTGAAACGTTTCAGATC
Deinococcus geothermalis DSM 11300
Dgeo_0672 aglA -47 6 GAACTGAATCGATTCAGTCG
Dgeo_2243 DR2501 -46 5.9 AGGCTAAATCGATTTAGATC
Dgeo_2244 DR2502 -55 5.9 GATCTAAATCGATTTAGCCT
Deinococcus radiodurans R1
DR2501 DR2501 -43 6 AGACTGAATCGTTTCAGTTG
DR2502 DR2502 70 6 CAACTGAAACGATTCAGTCT
DR1375 aglA 55 6.1 CATCTGAAACGATTCAGTCC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD