Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR2 in Ralstonia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Ralstonia solanacearum GMI1000
RSc2861 fruB -83 6.2 CAATGTAATCGATTTCAATC
RSc2861 fruB -226 5.4 CGCTGAAATCGTTTCCAAAG
RSc2860 fruR2 -20 5.4 CTTTGGAAACGATTTCAGCG
RSc2860 fruR2 -163 6.2 GATTGAAATCGATTACATTG
Ralstonia pickettii 12J
Rpic_3108 fruB -218 5 TGCTGAAATCGTTTCCAAAG
Rpic_3108 fruB -84 6.6 AACTGTAATCGATTTCAATT
Rpic_3107 fruR2 -153 6.6 AATTGAAATCGATTACAGTT
Rpic_3107 fruR2 -19 5 CTTTGGAAACGATTTCAGCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD