Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ScrR2 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR2 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus cereus ATCC 14579
BC0775 scrA -49 6.7 TTGCGGAACCGGTTCCATAA
Bacillus clausii KSM-K16
ABC3765 scrB -116 6.2 TTATGGAACCGGTTCCGAAG
ABC3765 scrB -54 6.8 TATTGGAACCGGTTCCTAAA
Bacillus halodurans C-125
BH1856 scrA -97 6.1 GAATGGAACCGGTTCCTAAA
BH1856 scrA -48 7 TTGTGGAACCGGTTCCTAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD