Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BH1250 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: BH1250 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anoxybacillus flavithermus WK1
Aflv_2275 BH1250 -56 6.3 ATATGAAAACGATTTCATTC
Bacillus cereus ATCC 14579
BC1083 BH1250 -96 5.9 TTAAGAAAACGTTTTCATGC
BC4015 BH2903 -183 6.1 AAAATAAAACGTTTTCATAT
BC4015 BH2903 -241 5.4 TTATGCAAACGTTTTCTTTG
Bacillus clausii KSM-K16
ABC0795 BH1249 -31 4.9 ATATGAGATCGATCTCAGAG
ABC1572 BH1250 -33 5.9 AAATGAGAACGTTTTCAATA
Bacillus halodurans C-125
BH1244 BH1244 -102 5.6 ATATGAGAACGATTCCATAG
BH1244 BH1244 -32 5.3 ATGTGAAATCGATTCCATAT
BH2903 BH2903 -32 4.7 TTACGTAAACGTTTTCGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD