Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Bphy_2245 in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bphy_2245 - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia phymatum STM815
Bphy_2245 Bphy_2245 -107 7.4 GAATGTAATCGATTACATTT
Burkholderia xenovorans LB400
Bxe_A3676 Bphy_2245 -143 7.6 AAATGTAATCGATTACATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD