Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Bphy_6994 in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: NULL
Effector:
Regulog: Bphy_6994 - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia phymatum STM815
Bphy_6992 Bphy_6992 -101 6.6 TTACTGTATCGATACACTAA
Burkholderia sp. 383
Bcep18194_B1309 Bphy_6992 -65 6.6 TTACTGTATCGATACACTAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD