Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator RbsR in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Regulog: RbsR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_5320 rbsR -66 6.5 CGATGTAATCGATTCCACGA
Streptomyces coelicolor A3(2)
SCO2745 rbsR -35 6.8 CCGTGTAATCGATTCCACGA
Streptomyces griseus subsp. griseus NBRC 13350
SGR_1097 rbsR -96 6.8 CCGTGTAATCGATTCCATGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD