Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SCO5692 in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: SCO5692 - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_2578 bglX -53 6.5 GCATCGAAGCGCTTCGAAAG
SAV_2577 SAV_2577 -151 6.6 ACATCGAAGCGCTTCGACTC
SAV_2578 bglX -235 6.3 GAGTCGAAGCGCTTCGATGT
SAV_2569 SCO5692 -125 6.6 TTGTCGAAGCGCTTCGACAG
Streptomyces coelicolor A3(2)
SCO5685 bglX -51 6.7 GCATCGAAGCGCTTCGACGT
SCO5685 bglX -160 6.2 GTGTCGAAGCGCTTCGATGT
SCO5686 SAV_2577 -218 6.3 ACGTCGAAGCGCTTCGATGC
SCO5686 SAV_2577 -109 6.7 ACATCGAAGCGCTTCGACAC
SCO5692 SCO5692 -124 6.9 GAGTCGAAGCGCTTCGACGG
Streptomyces scabiei 87.22
SCAB_25641 bglX -53 6.5 GCATCGAAGCGCTTCGAAAG
SCAB_25641 bglX -248 6.2 CAGTCGAAGCGCTTCGATGT
SCAB_25621 SAV_2577 -151 6.7 ACATCGAAGCGCTTCGACTG
SCAB_25511 SCO5692 -125 6.3 TGATCGAAGCGCTTCGACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD