Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Bamb_2736 in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bamb_2736 - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia cepacia AMMD
Bamb_2736 Bamb_2736 -51 6.6 GTTGACGAAATTTCGCCATC
Bamb_2737 SSF51658 -92 6.3 ATTGGCGATTTTTCGTCAAC
Burkholderia sp. 383
Bcep18194_A6011 Bamb_2736 -77 6.6 GTTGACGAAATTTCGCCATC
Bcep18194_A6012 SSF51658 -27 6.3 ATTGGCGATTTTTCGTCAAC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD