Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GntR2 in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Gluconate utilization
Effector: D-gluconate
Regulog: GntR2 - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Bacillus amyloliquefaciens FZB42
RBAM_017950 kdgK -53 6 TTACTAAACCGGTTTACCAA
RBAM_017950 kdgK -40 5.7 TTACCAAACCGATTTAGTCT
Bacillus clausii KSM-K16
ABC3358 gntR2 -32 6.8 CTACTAAATCGGTTTAGTAA
Geobacillus kaustophilus HTA426
GK1942 gntR2 -36 6.4 GAACTAAATCGATTTAGTCT
GK1940 null -115 6.6 TTACTAAATCGATTTAGCCC
GK2344 gnd -92 6.6 TTCCTAAATCGGTTTAGAAA
Oceanobacillus iheyensis HTE831
OB2705 gntR2 -54 6.8 TTACTAAATCGATTTACTAA
OB2705 gntR2 -41 5.6 TTACTAAACCGTTTTAGTTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD