Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GalR in Desulfovibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR - Desulfovibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Desulfovibrio desulfuricans G20
Dde_3654 galR -51 6.1 AACTGCAAACGTTTGCAGCA
Dde_3652 galT -91 5.7 AATTGCAAACGTTTGCATCA
Desulfovibrio salexigens DSM 2638
Desal_0508 galT -39 5.1 TTGCACAATCGTTTGCAGAA
Desal_0508 galT -63 6 TTCCGAAAACGTTTGCGGTT
Desal_0506 galR -101 5.2 AATGGAAAAGGTTTTCGGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD