Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SCO2753 in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector: New effector
Regulog: SCO2753 - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_5313 SCO2752 -72 6.6 CATAGAAAGCGCTTGCTGCG
SAV_5312 SCO2753 -182 6.6 CGCAGCAAGCGCTTTCTATG
Streptomyces coelicolor A3(2)
SCO2821 pel -89 4.9 CCGAGAAAGCGCTTTCCGCC
SCO2752 SCO2752 -87 6.5 CATAGAAAGCGCTTGCTGTA
SCO2753 SCO2753 -163 6.5 TACAGCAAGCGCTTTCTATG
Streptomyces griseus subsp. griseus NBRC 13350
SGR_217 pel -216 6.2 TGTAGAAAGCGCTTGCTGTC
SGR_4813 SCO2752 -39 6.5 GATAGAAAGCGCTTGCTACG
SGR_4812 SCO2753 -90 6.5 CGTAGCAAGCGCTTTCTATC
Streptomyces scabiei 87.22
SCAB_58381 SCO2752 -98 6.6 GATAGAAAGCGCTTGCTGTG
SCAB_58371 SCO2753 -163 6.6 CACAGCAAGCGCTTTCTATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD