Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BgaR in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: BgaR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces scabiei 87.22
SCAB_43661 gal6 -186 7.2 GGATGTTTACGTAAACATCC
SCAB_43681 bgaR -184 7.2 GGATGTTTACGTAAACATCC
Streptomyces coelicolor A3(2)
SCO7411 bgaR -156 7.1 TGATGTTTACGTAAACATGA
SCO7411 bgaR -111 6.9 TTATGTTTACGTAAACATCT
SCO7410 bgaZ -101 6.9 AGATGTTTACGTAAACATAA
SCO7410 bgaZ -56 7.1 TCATGTTTACGTAAACATCA
Streptomyces avermitilis MA-4680
SAV_1030 bgaZ -110 6.9 AGATGTTTACGTAAACATAA
SAV_1031 bgaR -92 6.9 TTATGTTTACGTAAACATCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD