Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Thermoanaerobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thermoanaerobacter tengcongensis MB4
TTE1952 iolR -30 6.2 TTATGTAATCTGTTACATAG
Thermoanaerobacter italicus Ab9
Thit_1753 iolR -29 6 TTATGTAATCTGTTACACAG
Thermoanaerobacter ethanolicus X514
Teth514_1072 iolR -118 4.7 CTATGGGAGTGCTTAAATAC
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_1172 iolG3 -38 6 TTATGTAATCAATTACACTA
Csac_1172 iolG3 -72 4.8 CGTTGTAATTGATTACACTA
Anaerocellum thermophilum DSM 6725
Athe_0344 iolG3 -72 5 CATTGTAATTGATTACACTA
Athe_0344 iolG3 -38 6.1 ATATGTAATCAATTACACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD