Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ManR in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Mannosides utilization; Mannose utilization
Effector: Mannose
Regulog: ManR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_2253 manA3 -164 4.8 AACCGACAACGATGTCAAGC
SAV_2253 manA3 -210 5.1 CGGCGACAACGTTGTCTGAG
SAV_1476 manK -172 6.4 CCTGGACAACGTTGTCAGAC
SAV_1477 manR -99 6.4 GTCTGACAACGTTGTCCAGG
SAV_2252 manA -51 5.7 AGTTGACAACGTTGTCCATT
Streptomyces coelicolor A3(2)
SCO6234 manA2 -49 6.1 GCGGGACAACGTTGTCAGGT
SCO6004 manA -42 5.9 ATTTGACAACGTTGTCCCAC
SCO6428 SCO6428 -41 6.4 GCTTGACAACGTTGTCCACC
SCO1077 manK -135 6.3 CCTGGACAACGTTGTCAGAT
SCO1078 manR -125 6.3 ATCTGACAACGTTGTCCAGG
Streptomyces griseus subsp. griseus NBRC 13350
SGR_1503 manA -47 6.2 CTATGACAACGTTGTCCAGG
SGR_6530 manK -93 6.4 CCTGGACAACGTTGTCAACA
SGR_6529 manR -133 6.4 TGTTGACAACGTTGTCCAGG
Streptomyces scabiei 87.22
SCAB_82741 manK -76 6.5 CCTGGACAACGTTGTCACGC
SCAB_82731 manR -112 6.5 GCGTGACAACGTTGTCCAGG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD