Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator SAV1329 in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactosides utilization
Effector: Beta-galactosides
Regulog: SAV1329 - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_1325 lacA -132 7.1 TTCTGTGAGCGTTCACAGTA
SAV_1326 SAV_1326 -73 7.1 TACTGTGAACGCTCACAGAA
Streptomyces scabiei 87.22
SCAB_83481 SAV_1326 -73 7.1 TACTGTGAACGCTCACAGAA
SCAB_83491 lacA -133 7.1 TTCTGTGAGCGTTCACAGTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD