Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KojR in Bacillales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Regulog: KojR - Bacillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anoxybacillus flavithermus WK1
Aflv_2026 kojR -13 7.2 AATCCGAAACGTTTTGGAGG
Aflv_2025 kojP -13 6.8 AATCCGAAACGTTTTGGGAA
Bacillus halodurans C-125
BH3692 kojR -26 7 CAACCGAAACGTTTTGGAGG
BH3691 gdb1 -153 7 AAACCGAAACGTTTTGGATT
BH3691 gdb1 -55 5.5 GATCCAAAACGTTTCGGATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD