Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator KojR in Thermoanaerobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Kojibiose utilization
Effector: Kojibiose
Regulog: KojR - Thermoanaerobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Anaerocellum thermophilum DSM 6725
Athe_0397 pgmB -70 4.8 TATTGAAAACAATTCGAAAA
Athe_0399 kojE -181 5.1 TTACGAAAACATTTCGAAAA
Athe_0399 kojE -48 5.6 CATCGAAAACATTTCCGAAA
Caldicellulosiruptor saccharolyticus DSM 8903
Csac_0438 pgmB -71 4.8 TATTGAAAACAATTCGAAAA
Csac_0440 kojE -53 5.2 TGTCGAAAACATTTCCGAAA
Thermoanaerobacter ethanolicus X514
Teth514_2203 kojR -33 6.7 CAACCAAAACGTTTTGGAAA
Teth514_2202 kojP -51 6.2 TACCCAAAACGTTTCGGATA
Thermoanaerobacter italicus Ab9
Thit_0753 kojR -33 6.7 CAACCAAAACGTTTTGGAAA
Thit_0754 kojP -49 6.3 TATCCAAAACGTTTCGGATA
Thermoanaerobacter tengcongensis MB4
TTE0797 kojR -31 6.4 TAACCAAAACGTTTTGGGAA
TTE0798 kojP -45 6.3 CATCCAAAACGTTTCGGATA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD