Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CelR in Streptomycetaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Cellobiose utilization
Effector: Cellobiose
Regulog: CelR - Streptomycetaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Streptomyces avermitilis MA-4680
SAV_1764 lamA1 -60 5.7 TCTTGAGAGCGCTCTCAAGG
SAV_1854 celA2 -209 6.3 CAGTGGGAGCGCTCCCATAT
SAV_1854 celA2 -66 5.1 CAGTGGGAGCGATTCCATCA
SAV_555 celA1 -220 6.3 TTTTGGGAGCGCTCCCAAGA
SAV_5253 bglC2 -88 5.7 CGATGGGAGCGCTTCCATGC
SAV_555 celA1 -75 5.9 GAATGGGAGCGCTCCCACCT
SAV_555 celA1 -51 5.5 TGATGGGAGCGCTCCCGAAC
SAV_2254 gunA 3 5.9 AGGTGGGAGCGCTCCCATAT
SAV_967 SCO0716 -102 5.1 TTCAGAGAGCGCTCTCAGAC
SAV_1053 SCO7559 -69 5.4 CTCTGAGAGCGCTCTCAATT
SAV_5257 celR -284 6.7 CCGTGGGAGCGCTCCCACAA
SAV_5256 cebE -134 6.7 TTGTGGGAGCGCTCCCACGG
SAV_1855 cbhB -75 6.3 ATATGGGAGCGCTCCCACTG
SAV_1855 cbhB -218 5.1 TGATGGAATCGCTCCCACTG
Streptomyces coelicolor A3(2)
SCO6665 lamA1 -85 5.7 CTCTGAGAGCGCTCTCAGAA
SCO0643 SCO0643 -74 6.3 CCTTGGGAGCGCTCCCATGC
SCO6548 cbhA -318 5.1 CAGTGGGAGCGGTTCCATCA
SCO2798 bglC2 -16 5.9 CTATGGGAGCGCTTCCATGC
SCO1187 gunA2 -87 6 AAGTGGGAGCGCTCCCATCA
SCO2794 celR -238 6.6 GTGTGGGAGCGCTCCCACAA
SCO7637 SCO7637 29 6.2 CTTTGGGAGCGCTCCCATCG
SCO0765 cel1 -54 6 ATTTGGGAGCGCTCCCATTC
SCO1187 gunA2 -61 5.3 AGTTGGGAGCGCTCCCGCAC
SCO0716 SCO0716 -53 5.7 GCGTGAGAGCGCTCTCAGGC
SCO7559 SCO7559 -62 5.4 CGCTGAGAGCGCTCTCAGAA
SCO2795 cebE -147 6.6 TTGTGGGAGCGCTCCCACAC
SCO6546 cbhB -79 6.5 CTATGGGAGCGCTCCCACTG
SCO6546 cbhB -221 5.1 TGATGGAACCGCTCCCACTG
Streptomyces griseus subsp. griseus NBRC 13350
SGR_4739 celR -109 6.2 TCTTGGGAGCGCTCCCAATA
SGR_2445 celA2 -33 6.3 GATTGGGAGCGCTCCCACAG
SGR_199 gunA -334 6.2 GTGTGGGAGCGCTCCCAGAT
SGR_4738 bglC2 -18 5.7 CCCAGGGAGCGCTCCCACAT
SGR_3212 cebE -55 5.5 ATTTGAGAGCGCTCTCAAGG
SGR_4735 cebE -124 6.3 GCATGGGAGCGCTCCCACTC
Streptomyces scabiei 87.22
SCAB_21081 gunA -180 6 GGGTGGGAGCGCTCCCATGT
SCAB_90091 cbhB -108 6.5 TCATGGGAGCGCTCCCACTG
SCAB_90091 cbhB -251 4.7 GTCGGGAACCGCTCCCACTG
SCAB_15711 lamA1 -140 5.7 TTTTGAGAGCGCTCTCAGGA
SCAB_16431 celA2 -131 5.1 TACTGGAAGCGCTTCCAATG
SCAB_16431 celA2 -116 6 CAATGGGAGCGCTCCCACCT
SCAB_17011 cbhB -133 6.3 ATATGGGAGCGCTCCCACTG
SCAB_17011 cbhB -286 5.3 TGGTGGAACCGCTCCCACTG
SCAB_57751 cebE -133 6.7 TCGTGGGAGCGCTCCCACAG
SCAB_17001 cbhA -314 6.3 CAGTGGGAGCGCTCCCATAT
SCAB_17001 cbhA -161 5.3 CAGTGGGAGCGGTTCCACCA
SCAB_57721 bglC2 -16 5.8 CAATGGGAGCGCTTCCATGC
SCAB_90081 celA1 -63 6.1 TCTTGGGAGCGCTCCCAATC
SCAB_8871 cel1 -93 5.9 AATTGGGAGCGCTCCCACTT
SCAB_5981 gunA2 -85 6.1 AAATGGGAGCGCTCCCAAAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD