Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator ScrR in Clostridia-1

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sucrose utilization
Effector: Sucrose-6-phosphate
Regulog: ScrR - Clostridia-1
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Clostridium beijerincki NCIMB 8052
Cbei_5012 scrA -68 6.7 ATATGGAACTGGTATCATAT
Clostridium perfringens ATCC 13124
CPF_1785 scrA -244 5.9 TTATGAAACTAATTCCATAT
CPF_1785 scrA -71 6.7 ATATGGAACTGATACCATAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD