Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia phymatum STM815
Bphy_5434 bglB -86 7.1 ATGTGGAAGCGCTTCCACTC
Burkholderia xenovorans LB400
Bxe_B2084 bglB -172 7.1 GTGTGGAAGCGCTTCCACTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD