Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Bamb_4155 in Burkholderia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bamb_4155 - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia cepacia AMMD
Bamb_4158 Bamb_4158 43 7.5 CGTTGCACACGTGTGCAACG
Burkholderia sp. 383
Bcep18194_B0939 Bamb_4158 192 7.5 CGTTGCACACGTGTGCAACG
Burkholderia vietnamiensis G4
Bcep1808_5293 Bamb_4158 -59 7.1 CGCTGCACACGTGTGCAGTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD