Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GalR in Pasteurellales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR - Pasteurellales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Aggregatibacter aphrophilus NJ8700
NT05HA_1259 galT -49 6.3 TTTTGTAATCGTTTTCATAA
NT05HA_1260 galR -224 5.7 TTATGAAAACGATTACAAAA
NT05HA_1260 galR -76 5.2 AAAAGTAAGCGTTTTCAAAT
NT05HA_1261 mglB -187 6.2 AGATGTAATCGTTTTCATAA
Haemophilus influenzae Rd KW20
HI0820 galT -39 6.2 TAATGTAATCGTTTACATTG
HI0821 galR -188 5.9 CAATGTAAACGATTACATTA
HI0822 mglB -113 6.1 TTATGTAATCATTTTCATTT
Haemophilus somnus 2336
HSM_0108 galT -52 6.3 ATTTGTAATCGTTTACATTT
HSM_0105 mglB -148 6.3 TTATGAAATCGTTTTCATAA
Mannheimia succiniciproducens MBEL55E
MS0646 galT -100 6.2 AAATGTAACCGTTTTCAATA
MS0644 galR -222 5.8 TATTGAAAACGGTTACATTT
MS0644 galR -91 5.7 AAAAGTAACCGTTTTCAATA
MS0643 mglB -161 5.9 TTATGTAATCGTTTCCACAT
Pasteurella multocida subsp. multocida str. Pm70
PM1036 galT -34 6 AAATGTAACCGTTTTCAGTT
PM1037 galR -209 5.6 AACTGAAAACGGTTACATTT
PM1038 mglB -142 6.1 AATTGTAATCGTTTTCACAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD