Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator HpxR in Ralstonia

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Xanthine utilization
Effector: Xanthine
Regulog: HpxR - Ralstonia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Cupriavidus taiwanensis
RALTA_B0719 uraA -203 6.9 TTACCAAAACGTTTTTGTTA
Ralstonia eutropha H16
H16_B0861 uraA -119 6.7 TTACCAAAACGTTTTTGTTT
Ralstonia eutropha JMP134
Reut_B4531 uraA -119 6.9 TAACCAAAACGTTTTGGCTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD