Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GalR in Vibrionales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR - Vibrionales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Photobacterium profundum SS9
PBPRB1872 mglB -154 5 TTGGGGGAACGTTTACATTA
PBPRA2082 galE -105 6 TCGTGGAAACGTTTACACAA
PBPRA2078 galR -152 5 TACTGATAACGATTACAAAA
Vibrio angustum S14
VAS14_15124 galE -131 6.4 AAATGTAAACGTTTACACAA
Vibrio cholerae O1 biovar eltor str. N16961
VC2337 galR -139 5.5 CATTAAAAACGTTTACACTT
VC1596 galT -162 5.6 TTGTGAAAGCGTTTACACTG
VC1325 mglB -107 5.4 CTGAGTAAACGTTTTCACTG
Vibrio fischeri ES114
VF_A0352 galE -247 5.6 GATTGTAAACGTTTACAATT
VF_A0352 galE -92 6.4 TAGTGTAAACGTTTACATTT
VF_A0361 galR -107 5.7 TAATGATAACGTTTACAAAA
Vibrio harveyi ATCC BAA-1116
VIBHAR_03325 galR -149 4.7 CTAAGATAACGTTTATACAT
VIBHAR_03331 galE -254 6 TTGTGTAAACGTTTATACAT
VIBHAR_03331 galE -153 5.4 TTGTGGAAACGTTTGCTCTA
Vibrio parahaemolyticus RIMD 2210633
VP2393 galR -149 5.6 AAAAGATAACGTTTACACTA
VP2400 galE -170 6.3 TTGTGGAAACGTTTACACAA
Vibrio shilonii AK1
VSAK1_00937 galW -103 5.6 CAGTGTAAACGTTTCCAGTT
VSAK1_10728 galE -238 4.7 TTGTGTAATCGTTTAACTTT
VSAK1_10728 galE -140 6.6 TAGTGTAAACGTTTACACTT
VSAK1_10743 mglB -327 5.5 TATTGTAAACGTTCTCATAA
VSAK1_10743 mglB -97 4.7 TGGGTTAAACGTTTTCACTT
VSAK1_00922 galR -115 5.2 TTTTGGAAACGATTACTCTA
VSAK1_00922 galR -245 5.6 TCATGGAAACGTTTACAATT
VSAK1_10773 lacE -58 5.6 CTGTGTAAACGTTTCCAAAT
VSAK1_10773 lacE -223 4.7 AATTGTTAACGTATCCAAAT
Vibrio vulnificus CMCP6
VV21332 galW -148 5.2 GTCTGTAAACGTTTCCATAA
VV1_1770 galE -125 6.4 TAGTGAAAACGTTTACACTT
VV21326 mglB -90 5.3 AAGGGTAAACGTTTTCACCA
VV1_1775 galR -139 5.6 AAAAGATAACGTTTACACTA
VV21682 VV21682 -119 4.8 AAATGCAATCGATTACACAT
VV21329 lacP -96 5.2 TCATGAAAACGTTTCCATAG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD