Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Alteromonadales bacterium TW-7
ATW7_07989 bglA2 -173 5.4 AGTTGGAAGCGCTTCCATAA
ATW7_07849 glcP -132 6.2 CTGTGAAAGCGCTTACATTT
ATW7_02192 lamA -92 6.1 AAATGTAAGCGCTTACAGAA
ATW7_02192 lamA -120 6.5 ATTTGTAAGCGCTTACAATT
ATW7_07974 omp(Bgl)1 -100 4.7 TTCTGGAAGCGCTTCCACAC
ATW7_07974 omp(Bgl)1 -140 5 TTCTGGAAGCGCTTCCACAT
ATW7_07994 bglA1 -129 4.8 ATATGGAAGCGCTTCCTGAA
ATW7_07994 bglA1 -71 5.5 TTATGGAAGCGCTTCCAACT
ATW7_07854 bglA1 -146 6 AAATGTAAGCGCTTTCACAG
Alteromonas macleodii 'Deep ecotype'
MADE_03795 glcP -64 6.1 AGATGTAAGCGCTTTCAAAT
MADE_03795 glcP -96 6.6 TTATGTAAGCGCTTACAAAA
MADE_03797 bglA1 -130 6.6 TTTTGTAAGCGCTTACATAA
MADE_03797 bglA1 -162 6.3 ATTTGAAAGCGCTTACATCT
Colwellia psychrerythraea 34H
CPS_3705 glcP -271 6.2 TTATGTGAGCGCTTACAAAA
CPS_3705 glcP -216 6 GGATGTAAGCGCTTACATTT
CPS_3698 omp(Bgl)1 -165 6.2 TTATGTAAGCGCTTACACCA
CPS_3706 bglA1 -126 6.2 AAATGTAAGCGCTTACATCC
CPS_3698 omp(Bgl)1 -449 6.5 AAATGTAAGCGCTTACAAAT
CPS_3698 omp(Bgl)1 -240 6.8 TTATGTAAGCGCTTACATTT
CPS_3706 bglA1 -71 6 TTTTGTAAGCGCTCACATAA
CPS_3697 CPS_3697 -108 6.6 ATTTGTAAGCGCTTACATTT
Glaciecola sp. HTCC2999
GHTCC_010100003724 GHTCC_010100003724 -99 6.7 AAATGTAAGCGCTTACATTT
GHTCC_010100001564 lamA -110 5.9 CTGTGGAAGCGCTTACATTT
GHTCC_010100001564 lamA -68 6.2 AGATGTAAGCGCTTACATCA
GHTCC_010100001604 glcP -72 6.2 CAATGAAAGCGCTTTCATTT
GHTCC_010100001609 bglA1 -103 6.3 AAATGAAAGCGCTTTCATTG
Idiomarina baltica OS145
OS145_00595 lamA -64 6.4 TTGTGAAAGCGCTTACATTT
OS145_00610 glcP -69 6.3 ACATGAAAGCGCTTACATAA
OS145_00615 bglA1 -73 6.3 TTATGTAAGCGCTTTCATGT
Pseudoalteromonas tunicata D2
PTD2_03951 glcP -124 6.4 ATGTGAAAGCGCTTACATTT
PTD2_03951 glcP -183 6.5 TTTTGTAAGCGCTTACAATT
PTD2_20417 lamA -91 6.3 AAATGGAAGCGCTTACATAA
PTD2_20417 lamA -132 6.4 TTATGAAAGCGCTTACATTC
PTD2_03956 bglA1 -52 6.3 AATTGTAAGCGCTTACAAAA
PTD2_03956 bglA1 -111 6.1 AAATGTAAGCGCTTTCACAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD