Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator FruR2 in Xanthomonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Xanthomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Stenotrophomonas maltophilia K279a
Smlt2555 fruR2 -126 6.8 TATTGGGAACGTTCCCACTG
Smlt2556 fruB 3 6.4 CAGTGGGAACGTTCCCAATA
Smlt2556 fruB -106 5.9 CATTGGAAACGTTCCCGGAA
Xanthomonas axonopodis pv. citri str. 306
XAC2500 fruR2 -17 5.1 GAGCGGGAACGGTCCCAGTG
XAC2500 fruR2 -128 7 TAGTGGGAACGTTCCCACGA
XAC2501 fruB -164 5.2 CACTGGGACCGTTCCCGCTC
XAC2501 fruB -53 7 TCGTGGGAACGTTCCCACTA
Xanthomonas campestris pv. campestris str. ATCC 33913
XCC2369 fruR2 -127 6.9 TAGTGGGAACGTTCCCACGG
XCC2370 fruB -165 5.2 CACTGGGACCGTTCCCGCTC
XCC2369 fruR2 -17 5.1 GAGCGGGAACGGTCCCAGTG
XCC2370 fruB -55 6.8 CCGTGGGAACGTTCCCACTA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD