Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GalR in Alteromonadales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR - Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Alteromonas macleodii 'Deep ecotype'
MADE_00229 galR -169 5.3 GAGGTTATACGTTTTCCGTT
MADE_00231 galT -136 6.4 TAGGGTAAACGTTTAACCCT
MADE_00241 omp_Gal -140 6.1 TATGGTAAACGTTTACCCAA
MADE_00230 galM -123 5.3 AACGGAAAACGTATAACCTC
Pseudoalteromonas haloplanktis TAC125
PSHAa1771 galR -111 6.3 AAGGGTAAACGCTTACCCCG
PSHAa1770 galT -54 6.3 CGGGGTAAGCGTTTACCCTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD