Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR2 in Corynebacteriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR2 - Corynebacteriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Corynebacterium glutamicum ATCC 13032
cg0210 iolR2 -73 6.3 CAATTGGAGCGCTCCAACAC
cg0211 iolG2 -86 6.3 GTGTTGGAGCGCTCCAATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD