Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR in Listeriaceae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside
Regulog: BglR - Listeriaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Listeria welshimeri serovar 6b str. SLCC5334
lwe1747 bglA -160 6.7 TTGTCGAAACGTTTCTATGA
lwe1746 bglX -290 6.7 TCATAGAAACGTTTCGACAA
Listeria seeligeri serovar 1/2b str. SLCC3954
lse_1701 bglA -160 6.5 TTGTCGAAACGTTTCTATAG
lse_1700 bglX -289 6.5 CTATAGAAACGTTTCGACAA
Listeria monocytogenes EGD-e
lmo1730 bglA -158 6.7 TTGTCGAAACGTTTCTATGA
lmo1729 bglX -289 6.7 TCATAGAAACGTTTCGACAA
Listeria innocua Clip11262
lin1840 bglX -290 6.7 TCATAGAAACGTTTCGACAA
lin1841 bglA -158 6.7 TTGTCGAAACGTTTCTATGA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD