Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator IolR in Micrococcineae

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Inositol utilization
Effector:
Regulog: IolR - Micrococcineae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Arthrobacter aurescens TC1
AAur_1987 iolR -91 6.4 ATTTTGTAGCGCTACAATTT
AAur_1986 iolG4 44 6.4 AAATTGTAGCGCTACAAAAT
Arthrobacter chlorophenolicus A6
Achl_0112 iolG5 -18 6.2 TTATTGGAGCGCTCCATAAT
Achl_0117 iolG4 -90 5.6 TTTATGGAGCGCTCCAAACA
Achl_0113 inoC -104 5.7 TTCATGGAGCGCTCCAAATG
Achl_0116 iolR -66 5.6 TGTTTGGAGCGCTCCATAAA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD