Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CC1627 in Caulobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: CC1627 - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC1628 null -81 4.7 CGATGAATTCGATTACATTG
CC1627 null -116 4.7 CAATGTAATCGAATTCATCG
CC1634 null -117 4.7 CAATGTAACCCATTTCATGG
CC1633 PF06439 -54 4.7 CCATGAAATGGGTTACATTG
Caulobacter segnis ATCC 21756
Cseg_2114 null -118 4.4 CGATGTAATCGAAATCATCG
Cseg_2107 null -119 4.7 CAATGTAACCCATTTCATGG
Cseg_2113 null -81 4.4 CGATGATTTCGATTACATCG
Caulobacter sp. K31
Caul_4613 null -119 4.3 TGATGTAATCGAAATCATCG
Caul_4607 PF06439 -78 4.7 CCATGAAATGGGTTACATTG
Caul_4612 null -83 4.3 CGATGATTTCGATTACATCA
Caul_4606 null -118 4.7 CAATGTAACCCATTTCATGG
Caul_0426 null -51 4.8 ATATGTAATCGAATACACAA
Phenylobacterium zucineum HLK1
PHZ_c2158 null -40 5.4 CGATGTAATCGATTACACGT
PHZ_c2157 null -67 5.4 ACGTGTAATCGATTACATCG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD