Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Jann_1459 in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Jann_1459 - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_1459 Jann_1459 -74 5.4 CTCTGAAATCGATTACATAC
Jann_1460 null -92 5.4 GTATGTAATCGATTTCAGAG
Oceanicola batsensis HTCC2597
OB2597_08889 Jann_1459 -84 5.1 CCTTGAAATCGATTACATCC
OB2597_08884 COG1082 -50 5.1 GGATGTAATCGATTTCAAGG
Paracoccus denitrificans PD1222
Pden_4766 Jann_1459 -62 4.9 GTCTGCAATCGATTGCAAAC
Pden_4767 COG1082 -54 4.9 GTTTGCAATCGATTGCAGAC
Rhodobacter sphaeroides 2.4.1
RSP_1243 Jann_1459 -93 5.7 TGATGTAATCGTTTGCAGAG
RSP_1243 Jann_1459 -61 4.3 CGCGACAAACGTTTACAACG
RSP_1244 COG1082 -109 4.3 CGTTGTAAACGTTTGTCGCG
RSP_1244 COG1082 -77 5.7 CTCTGCAAACGATTACATCA
Export
Regulatory Sites [ FASTA format ] DOWNLOAD