Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator GluR in Caulobacterales

Properties
Regulator family: LacI
Regulation mode:
Biological process: Carbohydrate metabolism
Effector: Glucose
Regulog: GluR - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC0337 sucC -259 5.9 TTATGACAACGTTGCCATTG
CC1471 ppdK -198 5.9 GCCGGACAACGTTGTCATTG
CC2057 zwf -73 6.5 TCATGACAACGTTGTCATAG
CC1224 gnl -56 5.1 CGGTGACATCGCTGTCATGG
CC2051 pykA -216 5.1 TAACGTCAACGTTGTCAGGT
CC2053 gluR -67 6.3 CCATGACAGCCTTGTCATGG
Caulobacter segnis ATCC 21756
Cseg_1378 gluR -66 6.3 CCATGACAGCCTTGTCATGG
Cseg_3807 sucC -224 4.4 GATGGAAAGCGTTGTCATCG
Cseg_1373 zwf -34 6.5 TCATGACAACGTTGTCATAG
Cseg_2660 gnl -117 5.4 CCGTGACATCGCTGTCATGA
Cseg_1380 pykA -219 4.6 TTACGTCAACGTTTTCAGGC
Cseg_1949 ppdK -207 5.6 TTTGGACAACGTTGTCATTG
Caulobacter sp. K31
Caul_0229 sucC -245 6 CCATGACAAGGCTGTCATTC
Caul_1438 zwf -30 6.5 TCATGACAACGTTGTCATAG
Caul_1443 pykA -119 5.7 GCTAGACAACGTTGTCAGGC
Caul_1442 gluR -68 5.9 CCTTGACAAGGCTGTCATGC
Caul_2179 ppdK -208 6 CCGAGACAACGTTGTCATTG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD