Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR2 in Caulobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Regulog: BglR2 - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC1103 glcT -124 5.8 GGTTGACAACGTTGTCACGT
CC0969 bglR2 -421 6.4 GAATGTCAACGTTGTCATTT
CC0970 omp(Bgl)2 -273 6.4 AAATGACAACGTTGACATTC
Caulobacter segnis ATCC 21756
Cseg_1232 glcT -123 5.8 GGTTGACAACGTTGTCACGC
Cseg_3735 bglR2 -409 6.1 GAATGTCAACGTTGTCATTG
Cseg_3734 omp(Bgl)2 -270 6.1 CAATGACAACGTTGACATTC
Caulobacter sp. K31
Caul_1420 glcT -69 5.5 GCTTGACAACGTTGTCACCG
Caul_2141 bglR2 -419 6.4 AAATGTCAACGTTGTCATTT
Caul_2141 bglR2 -105 5.9 GCATGACATCGTTGTCGTCC
Caul_2142 omp(Bgl)2 -242 6.4 AAATGACAACGTTGACATTT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD