Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator BglR1 in Caulobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Beta-glucosides utilization
Effector: Beta-glucoside; Glucose
Regulog: BglR1 - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter crescentus CB15
CC1754 omp(Bgl)1 -98 6.7 AATTGGAAGCGCTTCCATAG
Caulobacter sp. K31
Caul_2063 omp(Bgl)1 -108 6.9 TGTTGGAAGCGCTTCCAATG
Export
Regulatory Sites [ FASTA format ] DOWNLOAD