Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator Jann_3936 in Rhodobacterales

Properties
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Jann_3936 - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Jannaschia sp. CCS1
Jann_3935 RL4252 -63 6.4 GATTTATAACGTTTTAATTC
Jann_3935 RL4252 -192 5.5 GATTTTAAACGTTTCAATAG
Jann_3936 Jann_3936 -194 6.4 GAATTAAAACGTTATAAATC
Jann_3936 Jann_3936 -65 5.5 CTATTGAAACGTTTAAAATC
Export
Regulatory Sites [ FASTA format ] DOWNLOAD