Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator AduR in Rhizobiales

Properties
Regulator family: LacI
Regulation mode:
Biological process: Adenosine utilization
Effector: Adenosine
Regulog: AduR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Agrobacterium tumefaciens str. C58 (Cereon)
Atu4420 aduR -36 7.2 CTGATTAAACGTTTAATCAG
Rhizobium etli CFN 42
RHE_CH03414 aduR -32 7.2 CTGATTAAACGATTAATCAG
Rhizobium leguminosarum bv. viciae 3841
RL3877 aduR -34 6.8 CTGATTAAACGATTAATCAA
Sinorhizobium meliloti 1021
SMb21272 aduR -43 6.3 CAGCTTAATCGTTTAATCAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD