Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Desulfuromonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Desulfuromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pelobacter propionicus DSM 2379
Ppro_0832 cadA -56 5.1 ACCCTGAAGTGGGTACAGGCT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD