Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Caulobacterales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Caulobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Caulobacter sp. K31
Caul_2301 czcD -34 6.5 ATCCTCTAGTGGCTAGAGGAT
Phenylobacterium zucineum HLK1
PHZ_p0236 czcD -19 5.7 ATCCTCTACCTACTAGAGGAT
PHZ_c1429 czcD -103 6.5 ATCCTCTAGCGACTAGAGGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD