Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Sphingomonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Sphingomonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Erythrobacter litoralis HTCC2594
ELI_04460 czcD -37 5.7 ATCCTCCAGTAACTGGAGATT
Novosphingobium aromaticivorans DSM 12444
Saro_2151 czcD -63 4.6 ACCCTGTAGTTGCTACAGGGT
Sphingopyxis alaskensis RB2256
Sala_2444 czcD -19 6.2 ATCCTCCAGTGACTGGAGGAT
Sala_2560 czcD -34 5.4 CTTCTACAGTTACTGGAGGTT
Sphingobium japonicum UT26S
SJA_C1-05430 czcD -35 5.3 CTTCTACAGCGACTGGAGGTG
Zymomonas mobilis subsp. mobilis ZM4
ZMO0204 czcD -60 5 ACCCTATAGTAACTATAGACT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD