Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Rhodospirillales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Rhodospirillales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodospirillum rubrum ATCC 11170
Rru_A1027 cadA -66 6.2 ATCCTCTAGTCGCTAGAGATT
Magnetospirillum magnetotacticum MS-1
Magn03007548 czcD -192 5.7 AACCTCCAGTGACTGGAGATC
Azospirillum sp. B510
AZL_a07690 cadA -58 6 ATCCTCCAGTCGCTAGAGAAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD