Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Rhodobacterales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Rhodobacterales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Rhodobacter sphaeroides 2.4.1
RSP_1791 cadA -70 5.1 AACCTATAGTTGCTAGAGACA
Paracoccus denitrificans PD1222
Pden_2344 cadA -75 6.1 AAGCTCTAGTCGCTAGAGGAA
Pden_0212 cadA -37 5.8 AACCTCTAGTTGCTAGAGATC
Rhodobacterales bacterium HTCC2654
RB2654_22328 cadA -228 5.3 AAGCTCTAGTTACTGTAGGGG
RB2654_22408 PF01841 -78 5.1 AAGCTACAGTGACTGTAGCAA
RB2654_10329 czcD2 -50 6.3 AACCTCTAGTCGCTAGAGGAA
RB2654_22398 cadR -119 5.7 ATCCTCTAGCTACTGTAGGTT
RB2654_22323 PF03734 -150 5.3 AACCTCTAGTAGCTTTAGGAG
Oceanicola granulosus HTCC2516
OG2516_17805 cadA -63 5.1 AACCTACAGTCGGTAGAGGTC
Oceanicola batsensis HTCC2597
OB2597_05255 PF01841 -45 4.9 AAGCTACAGTCGCTGTAGCAA
OB2597_05245 cadR2 -124 5.1 AAGCTACAGTGGGTAGAGGTT
OB2597_16652 PF01841 -57 5.1 AAGCTACAGTGACTGTAGCAA
OB2597_16572 cadA -228 5.3 AAGCTCTAGTTACTGTAGGGG
OB2597_05215 cadA -62 5 AACCTACAGTTGCTGTAGGTC
OB2597_16642 cadR -134 5.7 ATCCTCTAGCTACTGTAGGTT
OB2597_16567 PF03734 -150 5.3 AACCTCTAGTAGCTTTAGGAG
Roseovarius nubinhibens ISM
ISM_17525 PF01841 -64 5.6 AAGCTATAGTGACTATAGCAA
ISM_17615 cadA -201 5.2 AAGCTCTAGCTACTGTAGGGG
ISM_17625 PF03734 -152 5.6 AACCTCTAGCCACTAGAAGTC
ISM_17535 cadR -129 6 ATCCTCTAGCAGCTAGAGGTT
Roseovarius sp. 217
ROS217_02950 cadR -135 5.7 ATCCTCTAGCTACTGTAGGTT
ROS217_03080 cadA -271 5.3 AAGCTCTAGTTACTGTAGGGG
ROS217_13921 czcD -128 5.8 AAGCTCTAGTCACTAGAGAGA
ROS217_02920 PF03734 -111 5.3 AAGCTCTAGTTGGTAGAGGTT
ROS217_02925 PF03734 -60 5.1 AAGCTCTAGTGGGTGGAGGTC
Sulfitobacter sp. EE-36
EE36_00940 null -61 4.8 AAGCTACAGTTGCTGTAGGTC
Silicibacter TM1040
TM1040_2930 czcD -71 6.3 AACCTCTAGTCACTAGAGCAA
Roseobacter sp. MED193
MED193_02180 cadA -60 5.2 AAGCTCTAGCTACTGTAGGGG
MED193_02240 cadR -117 6.2 ATCCTCTAGCTACTAGAGGTT
MED193_02255 PF01841 -57 4.9 AAGCTACAGTAACTATAGAGA
MED193_02170 PF03734 -88 5.6 AACCTCTAGCCACTAGAAGTC
MED193_15017 cadA -58 5.9 AACCTCTAGTCACTGTAGGTC
Hyphomonas neptunium ATCC 15444
HNE_1727 czcD -53 5.9 ATCCTCTAGTTACTTGAGGAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD