Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Rhizobiales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Rhizobiales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Sinorhizobium meliloti 1021
SMc04128 cadA -54 6 AACCTCTAGCCGCTAGAGGAC
Rhizobium sp. NGR234
NGR_c34490 cadA -54 6 TAGCTCTAGTCGCTAGAGGTT
Rhizobium leguminosarum bv. viciae 3841
RL4262 cadA -58 6.3 CACCTCTAGTCGCTAGAGGAT
Rhizobium etli CFN 42
RHE_CH03719 cadA -58 6.3 CACCTCTAGTCGCTAGAGGAT
Agrobacterium tumefaciens str. C58 (Cereon)
Atu0889 null -20 5.2 TATCTCCAGTCTCTAGAGATA
Atu0843 cadA -59 5.8 AAGCTCTAGTTGCTAGAGGTG
Mesorhizobium sp. BNC1
Meso_4426 cadR2 -34 5.1 ATGCTTTAGTCGCCAGAGGAT
Meso_4216 PF00501 -64 4.4 ATTCTGTAGTGGCCACAGGAA
Meso_4216 PF00501 -280 5 ATTCTTTAGTGGCTACAGAAT
Meso_2849 cadA -57 6.2 CTCCTATAGTCACTAGAGGAA
Meso_4129 cadA2 -57 5.3 ACCCTCTAGCTGCTATAGGTC
Mesorhizobium loti MAFF303099
mll2475 cadA -97 6.1 AAGCTCTAGTGACTAGAGCAA
Brucella melitensis 16M
BMEI0053 cadA -63 6.3 CTCCTCTAGTTACTAGAGGAT
Rhodopseudomonas palustris CGA009
RPA3260 cadA -59 4.6 ACCCTGTAGCCGCTACAGGGT
Bradyrhizobium sp. BTAi1
BBta_7421 cadA -46 6.2 CTCCTCTAGCGACTAGAGGAC
Nitrobacter winogradskyi Nb-255
Nwi_3134 cadA -59 5.1 ACCCTATAGTTACTACAGGGT
Azorhizobium caulinodans ORS 571
AZC_1456 cadA -55 6.4 CTCCTCTAGTGACTAGAGGAC
Xanthobacter autotrophicus Py2
Xaut_3978 cadA -28 6 CTCCTCTAGTGACTAGAGTAT
Xaut_3338 cadA -28 6 CTCCTCTAGTGACTAGAGTAT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD