Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Various betaproteobacteria

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Various betaproteobacteria
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Thauera sp. MZ1T
Tmz1t_2390 cadA -57 5.4 ACTCTGTAGTGACTACGGATT
Tmz1t_2103 cadA -57 5.4 ACTCTGTAGTGACTACGGATT
Dechloromonas aromatica RCB
Daro_2631 cadA -49 5.6 ACTCTGTAGCCACTCAAGGGT
Daro_2257 cadA -58 6.5 ACCCTATAGTAGCTACAGGGT
Chromobacterium violaceum ATCC 12472
CV1154 cadA -154 6.7 ACCCTGTAGTGACTACAGGGT
Laribacter hongkongensis HLHK9
LHK_00449 cadA -48 6.2 ACCCTATAGTAGCTCCAGGGT
Methylobacillus flagellatus KT
Mfla_0694 czcD -16 5.3 ACCCTCTAGTAACTTGATGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD