Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Comamonadaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Comamonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acidovorax avenae subsp. citrulli AAC00-1
Aave_1815 cadA -328 5.2 ACCTTGAAGCGGCTTGAAGGT
Acidovorax sp. JS42
Ajs_1335 cadA -34 5.5 ACTCTATACCCACTTCAGGGT
Ajs_1241 pbrR -54 6.3 ACTCTATAGTTACTATAGAGT
Ajs_1242 cadA -61 6.3 ACTCTATAGTAACTATAGAGT
Ajs_3474 czcD -61 5.2 ACATTATAGCTACTATATAGT
Ajs_2594 cadA -34 5.7 ACCTTGGAGTGGCTTCAAGGT
Comamonas testosteroni KF-1
CtesDRAFT_1695 cadA -55 5.8 ACTCTATACCAACTACAGGGT
CtesDRAFT_2651 pbrR -44 6.3 ACCCTATAGCTACTATAGAGT
CtesDRAFT_2650 cadA -61 6.3 ACTCTATAGTAGCTATAGGGT
CtesDRAFT_1793 cadA -150 4.7 ACTCTCAATCTGCTTTAGGGT
CtesDRAFT_0050 cadA -34 5 ACCTTGAAGTGACTTTATTGT
Delftia acidovorans SPH-1
Daci_0479 cadA -274 5.7 ACCTTGGAGCTACTCCAAGGT
Daci_2915 cadA -34 4.9 ACCTTGAAGTGACTTCACCGT
Polaromonas naphthalenivorans CJ2
Pnap_4001 cadA -50 4.9 ACCTTCAAGTGGGTTCAGGGT
Polaromonas sp. JS666
Bpro_3481 czcD -60 5.3 ACCTTGAAGTGGGTCCAGGGT
Rhodoferax ferrireducens DSM 15236
Rfer_0854 cadA -54 5.7 ACTCTATACCTACTATAGGGT
Variovorax paradoxus S110
Vapar_3562 cadA -26 4.8 ACTCTACACCTGCTTCAGGGT
Verminephrobacter eiseniae EF01-2
Veis_2983 czcD -57 6.2 ACCCTAGAGTTGCTACAGGGT
Veis_1666 czcD -68 4.7 ACCATCGATCGACTCCAGGGT
Methylibium petroleiphilum PM1
Mpe_A2353 pbrT -78 5.4 ACCCTGTAGTGGCTACGGACT
Mpe_A1655 czcD -55 6 ACTCTGGAGCAGCTACAGGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD