Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Burkholderia

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Burkholderia
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Burkholderia pseudomallei K96243
BPSL3378 cadA -57 6.4 ACCTTGTAGTGACTACAAGGT
Burkholderia mallei ATCC 23344
BMA2976 cadA -414 6.4 ACCTTGTAGTGACTACAAGGT
Burkholderia sp. 383
Bcep18194_A3304 cadA -57 6.1 ACCTTGTAGTGGCTTCAGGGT
Burkholderia cepacia AMMD
Bamb_0114 cadA -622 6.1 ACCTTGTAGTGGCTTCAGGGT
Burkholderia vietnamiensis G4
Bcep1808_0131 cadA -517 6.1 ACCTTGTAGTGGCTTCAGGGT
Burkholderia glumae BGR1
bglu_1g00910 cadA -57 5.9 ACCTTGAAGTGGCTTCAGGGT
Burkholderia xenovorans LB400
Bxe_B2911 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Bxe_A1118 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Bxe_C0883 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Bxe_A2903 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Bxe_A1104 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Bxe_C0391 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Bxe_A4439 cadA -353 6 ACCTTGTAGTGGCTTCAAGGT
Bxe_B1605 czcD -61 5.5 ACCTTATAGTAGCTTTATAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD