Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Moraxellaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Moraxellaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Acinetobacter sp. ADP1
ACIAD3600 czcD -51 4.9 ACCTTGGAGTGACTCCAGCCT
Acinetobacter baumannii AB0057
AB57_0301 czcD2 -61 5.2 ACATTATAGCTACTATATAGT
AB57_1125 czcD -57 5.4 ACTCTGGAGCTACTCAAGGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD