Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Pseudomonadaceae

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Pseudomonadaceae
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Pseudomonas aeruginosa PAO1
PA3690 cadA -60 6.4 ACTCTGTAGTTGCTACAGGGT
Pseudomonas entomophila L48
PSEEN4285 czcR -57 5.1 ACCCTGATACAGCTACAGGGT
PSEEN5232 cadA -163 6.5 ACCCTATAGTGGCTACAGGGT
Pseudomonas putida KT2440
PP1438 czcR -56 5.8 ACCCTGATGTCACTACAGGGT
PP5139 cadA -58 6.5 ACCCTATAGTGGCTACAGGGT
Pseudomonas syringae pv. tomato str. DC3000
PSPTO5279 cadA -59 6.5 ACCCTATAGTGGCTACAGGGT
Pseudomonas fluorescens Pf-5
PFL_3147 czcR -71 5.8 ACCCTATAGCTACTACAGACT
Pseudomonas mendocina ymp
Pmen_4225 cadA -57 6.6 ACCCTATAGTGACTACAGGGT
Pmen_1174 czcR -115 6.3 ACCCTGTAGTAACTACAGGGA
Pseudomonas stutzeri A1501
PST_0664 cadA -210 6.2 ACCCTGTAGTGGCTTTAGGGT
PST_1619 czcD -57 6.6 ACCCTGTAGTTGCTACAGGGT
PST_3416 czcD2 -61 5.9 ACCTTGTAGTAGCTATAGGGC
Azotobacter vinelandii AvOP
Avin_18520 cadA -114 6.3 ACTCTGTAGTGGCTACAGAGT
Avin_24510 czcD -58 6.1 ACCCTGAAGCCGCTACAGGGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD