Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Profile of regulator CadR-PbrR in Oceanospirillales/Alteromonadales

Properties
Regulator family: MerR
Regulation mode: activator
Biological process: Lead resistance; Cadmium resistance
Effector: Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog: CadR-PbrR - Oceanospirillales/Alteromonadales
Member of regulog collections
Transcription factor binding sites
Locus Tag Name Position Score Sequence
Hahella chejuensis KCTC 2396
HCH_03680 czcD -58 5.5 ACCCTGTAGCGACTCCAGACT
Marinobacter aqueolei
Maqu_1408 czcD2 -61 5.9 ACCTTATAGTGACTATATAGT
Maqu_3109 czcD -55 6.6 ACCCTGTAGCAACTACAGGGT
Maqu_3273 czcD2 -61 6.6 ACCCTGTAGTGGCTACAGGGT
Maqu_4003 czcD2 -61 5.5 ACCTTATAGTAGCTTTATAGT
Maqu_1294 czcD2 -61 6.6 ACCCTGTAGTGGCTACAGGGT
Maqu_3210 czcD2 -61 6.6 ACCCTGTAGTGGCTACAGGGT
Maqu_0893 czcD2 -40 5.5 ACCTTATAGTAGCTTTATAGT
Marinobacter sp. ELB17
MELB17_04522 czcD -57 6.6 ACCCTGTAGCTACTACAGGGT
Oceanospirillum sp. MED92
MED92_00235 czcD -59 6.5 ACCCTATAGCTACTACAGGGT
Saccharophagus degradans 2-40
Sde_1960 czcD -57 6.3 ACTCTATAGTTACTATAGAGT
Cellvibrio japonicus Ueda107
CJA_1839 czcD -63 6.2 ACCCTCTAGTAACTATAGAGT
Alcanivorax borkumensis SK2
ABO_1368 czcD2 -61 5.5 ACCTTATAGTAGCTTTATAGT
Export
Regulatory Sites [ FASTA format ] DOWNLOAD